T.c.

Tıp kategorisine 12 Temmuz, 2007 tarihinde eklendi, 37 defa okundu

T.C.

ANKARA ÜNİVERSİTESİ

ARAŞTIRMA FONU PROJESİ

KESİN RAPORU

GSTM1 Geninin Normal Bireylerde ve Akciğer Kanserli

Hastalarda RFLP Analizi ile İncelenmesi

Proje Yürütücücsü: Dr.Sümer ARAS

Proje numarası: 2000-07-05-018

Başlama Tarihi: 26. Haziran 2000

Bitiş Tarihi: 26. Haziran 2001

Rapor Tarihi: 26. Haziran 2001

GSTM1 Geninin Normal Bireylerde ve Akciğer Kanserli Hastalarda RFLP Analizi ile İncelenmesi

An Investigation on the Frequency of GSTM1 gene in Turkish population by RFLP: A Correlation Between Null Allele Gene Frequency and Lung Cancer

ÖZET

Sitozolik glutatyon S-transferaz süpergen ailesine üye olan enzimler pek çok karsinogenik elektrofili detoksifiye etme kapasitesine sahip dimerik yapıda enzimlerdir. Sigara dumanında bulunan bir çok bileşenin yanı sıra polisiklik aromatik hidrokarbonlar bu enzimlerin en önemli substratlarıdır. Bu enzim ailesinin bir üyesi olan GSTM1 polimorfik yapıdadır. Çalışmalar bu enzimin aktivitesinin olmadığı bireylerde akciğer kanseri riskinin arttığını göstermiştir. Bugüne kadar pek çok değişik popülasyonda yapılan incelemeler null allel frekansının toplumlar arasında farklılık gösterdiğini ortaya koymuştur. Bu çalışmada Türk toplumunda normal bireylerde ve akciğer kanserli hastalarda GSTM1 null allel frekansı incelenmiştir. Elde edilen sonuçlara göre akciğer kanserli hastalarda GSTM1 null allel frekansı (N=44) % 72.7, normal bireylerde ise (N=100) % 66 olarak bulunmuştur. Akciğer kanserli hastalarda null allel frekansı normal bireylerden yüksek olmasına karşın bu fark istatistiksel anlam taşımamaktadır (OR=0.73; %95 CL=0.33-1.59). Elde edilen bu ilk sonuçlar GSTM1 null genotipinin Türk hastalarda akciğer kanser gelişimine bir katkısı bulunmadığını savunmaktadır.

ABSTRACT

The enzymes that are the members of cytosolic glutathione S-transferase supergene family have the capacity to detoxify carcinogenic electrophiles. Many compounds which are present in the tobacco smoke and also aromatic hydrocarbons are the substrates of these enzymes. Polymorphic GSTM1 is a member of this supergene family. A series of studies have suggested that individuals lacking GSTM1 could potentially be at higher risk for lung cancer. In different ethnic groups variations in null allele frequency has been observed. In this present study GSTM1 null allele frequency was investigated in Turkish population among healthy individuals and also in patients with lung cancer. According to the results GSTM1 null allele frequency was found to be (N= 44) 72.7% among lung cancer patients and (N= 100) 66% in normal population. Although the GSTM1 null genotype is somewhat over represented among the lung cancer patients the difference was not statistically significant (OR=0.91, %95 CL=0.38-2.21). These results indicate that GSTM1 null genotype has no effect on lung cancer risk in Turkish patients.

II. Amaç ve Kapsam

Glutatyon S-transferazlar memeli dokularında ekspres edilen ve çok geniş substrat spesifitesine sahip olan bir enzim ailesidir. Primer yapılarına göre sitozolik enzimler a,m,p,d,q olmak üzere beş sınıfa ayrılırlar. Bu enzimlerin çoğu detoksifikasyon reaksiyonlarında görev alırlar ve redükte glutatyonun, konjugasyonunu katalizlerler. Bu aileye ait enzimleri kodlayan pek çok gen insanda polimorfiktir. Bunlardan GSTM1 geni, polisiklik aromatik hidrokarbonların detoksifikasyonunda rol alan GST m sınıfı bir izoenzimi kodlar (1). Sigara içenlerde GSTM1 aktivitesi bulunmamasının akciğer kanseri için daha büyük bir risk faktörü oluşturduğu gösterilmiştir (2, 3, 4). Beyaz ırkta bu enzimin aktivitesi %40-45 oranında bulunmuştur (5). Takip eden çalışmalarda GSTM1 null fenotipinin GSTM1 geninin homozigot delesyonuna bağlı olduğu gösterilmiştir. Bu buluş GSTM1 polimorfizminin non-invasiv şekilde RFLP analizi ile ve daha sonra PCR çalışmaları ile tespit edilebilmesini mümkün kılmıştır (6). Pek çok RFLP çalışmasında elde edilen sonuçlar GSTM1 izoenziminin akciğer kanserine karşı koruyucu bir etki oluşturabileceği fikrini desteklemesine karşın diğer bazı çalışmalar GSTM1 null alleli ve akciğer kanseri arasında önemli bir ilişkinin bulunmadığını savunmaktadır (1,5,7,2,6).

Gen sıklığı pek çok ayrı popülasyonda incelenmiş olup Japonlarda yüksek olduğu anlaşılmış ve ayrıca akciğer kanseri ile ilişkisi tam olarak belirlenmiştir (7). Bunun yanı sıra gen sıklığı Fransa, İngiltere, İspanya gibi Avrupa ülkelerinde de incelenmiş, frekansın daha düşük olduğu tespit edilmiş ve kanser bağıntısında rol oynayabileceği gösterilmiştir (5, 2, 6).

Çalışmamızda amaç doğrultusunda, Orta Anadolu’da yaşayan sağlıklı bireylerden alınan örneklerde ve akciğer kanseri hastalarında GSTM1 gen polimorfizimi incelenmiş, diğer toplumlara ait sonuçlarla karşılaştırılmıştır.

III. Materyal ve Yöntem:

Kan Örnekleri:

Kontrol grubunu oluşturan kan örnekleri her iki cinsiyetten, yaşları 20 ile 65 arasında değişen ve Orta Anadolu’da yaşayan, sağlıklı gönüllülerden alındı. Kanser veya herhangi bir kronik hastalık öyküsü bulunan bireyler çalışmaya dahil edilmedi.

Akciğer kanseri hastalarına ait örnekler Ankara Üniversitesi Tıp Fakültesi Göğüs Hastalıkları bölümünde ve Başkent Üniversite Hastanesinde teşhis edilen hastalardan alındı.

DNA İzolasyonu:

DNA, taze periferal kan örneklerinden fenol-kloroform ekstraksiyon yöntemi ile izole edildi (8). İzole edilen DNA örnekleri TE tampon çözeltisi (10mM Tris, 1mM EDTA pH:8.2) içerisinde çözüldü ve kullanılana kadar –20oC’da saklandı.

PCR Amplifikasyonu:

GSTM1 polimorfizim analizi daha önce Zhong ve ark, (9) ve Hirhovonen ve ark (13) tarafından açıklanan protokole göre yapıldı. PCR amplifikasyonunda üç ayrı primer kullanıldı; primer 1: 5’ CGCCATCTTGTGCTACATTGCCCG 3’; primer 2: 5’ ATCTTCTCCTCTTCTGGGTTCCTTCC 3’; primer 3: 5’ TTCTGGATTGTAGCCAGATCA 3’. Primer 3 özel olarak GSTM1 genini amplifiye ederken, primer 1 ve 2, m sınıfı başka bir geni (GSTM4) de amplifiye etmektedir (10). Bu üç primerle kontrol olarak kabul edilen 158 baz çiftlik ve GSTM1 pozitif genotipi gösteren 231 baz çiftlik iki ürün elde edildi (Şekil 1).

İstatistik Analiz:

Verilerin değerlendirilmesinde, One Way Anoava, Chi Square, ve Student’s t-testleri kullanıldı.

IV. Analiz ve Bulgular

GSTM1 genotiplerinin sınıflandırılması amacıyla uygulanan PCR analiz sonuçları Şekil 1’de gösterilmiştir. Ekson 4 ve 5 bölgelerine ait üç primer kullanılmıştır. Polimorfik GSTM1 geni, 231 bazçifti PCR ürününün varlığı veya yokluğu ile tespit edilmiştir. Kontrol olarak kullanılan 158 baz çiftlik fragman tüm örneklerde bulunmuştur (9,5). Tablo I çalışmaya dahil edilen hastaların özelliklerini göstermektedir. Hastaların büyük kısmı (%84.1) uzun süredir günde bir paketin üzerinde sigara içen bireylerdir. Hasta ve kontrol grubunda belirlenen GSTM1 polimorfizim dağılımı Tablo II’de gösterilmiştir. Sağlıklı bireylerin %66’sında, hasta grubun ise %72.7’sinde genin delesyonu gözlenmiştir. GSTM1 null genotipi hasta grubunda yüksek olmasına karşın bu fark istatistiksel bir anlam taşımamaktadır (OR= 0.73; %95 CL= 0.33-1.59). GSTM1 geninin bireyler arası dağılımı Şekil 2’de gösterilmiştir.

Şekil 1. GSTM1 and GSTM4 genlerine ait PCR ürnlerinin agaroz jel elektroforezi ile ayırılması. M 1 kb ladder markör . 158 baz çiftlik PCR ürünü tüm örneklerde gözlendi , 231 baz çiftlik PCR ürünü ise sadece GSTM1 genini taşıyan bireylerde gözlendi. Şerit 1, 2, : GSTM1 null genotipleri; Şerit 3, 4, 5,: GSTM1 pozitif genotipler.

Şekil 2. GSTM1’in kontrol ve akciğer kanseri için patolojik değerlendirme ile beraber oranları.

Şekil GSTM1+ genotipe sahip bireylerin oranını göstermektedir..

Tablo I. Akciğer kanseri hastalarının özellikleri

No(%)

Ortalama Yaş (+ SD)

Cinsiyet (E/K)

Sigara Alışkanlığı (+/-)

Akciğer kanseri vakaları

44 (100%)

59.77 (+ 10.03)

40/4

37/7

Yassı hücreli karsinoma

23 (52.3%)

60.48 (+ 10.67)

22/1

22/2

Adenokarsinoma

10 (23.7%)

57.90 (+8.76)

9/1

8/2

Küçük hücreli karsinoma

9 (20.5%)

61.78 (+9.99)

7/2

6/3

Diğer

2 (4.5%)

52 (+11.31)

2/0

2/0

Tablo II. GSTM1 polimorfik geninin akciğer kanserli hastalarda ve kontrol grubunda genotipik dağılımı

GSTM1+ GSTM1-

Tüm akciğer kanseri vakaları (n=44)

12 (27.3%)

OR

0.73

%95 CL

0.33-1.59

(p>0.05)

Yassı hücreli karsinoma (n=23)

5(21.7%)

OR

0.54

%95 CL

(0.18-1.58)

(p>0.05)

Küçük hücreli karsinoma (n=9)

5(55.6%)

OR

2.43

%95 CL

0.61-9.63

(p>0.05)

Adenokarsinoma (n=10)

2(20%)

OR

0.49

%95 CL

0.1-2.41

(p>0.05)

Diğer (n=2)

Uygulanamaz

Sağlıklı kontroller (n=100)

34(34%)

32 (72.7%)

18(78.3%)

4(44.4%)

8(80%)

66(66%)

V. Sonuç ve Öneriler:

Polimorfik genlerin metabolik polimorfizim ve akciğer kanseri riski ile ilişkili rolleri geniş ölçüde incelenmiştir. Pek çok çalışma metabolize edici enzimlere ait polimorfik GSTler gibi genlerin, akciğer kanserinde özellikle sigara tüketenlerde önemli olduğunu göstermiştir (11, 12, 13, 9).

Bazı çalışmalar düşük seviyede lökositik GSTM1 ile akciğer kanseri arasında bir ilişki olduğunu savunmaktadır (14, 15). GSTM1 geni metabolik polimorfizim ve akciğer kanseri ile olan ilişkisi açısından iyi çalışılmış bir gen olmasına karşın, null allelin etkisi tam olarak açıklığa kavuşturulabilmiş değildir. Mc Williams ve ark gerçekleştirdikleri meta analiz çalışmasında GSTM1 enziminin olmaması durumunun akciğer kanserinin gelişmesi için bir risk faktörü olduğunu göstermişlerdir (16), buna karşın Deakin ve ark herhangi bir etkileşimin bulunmadığını savunmaktadır (2). Bu çalışmada Türk popülasyonunda ve Türk kanser hastalarında GSTM1 gen polimorfizimi değerlendirilmiştir. Çalışmaya alınan sağlıklı bireyler Orta Anadolu’da genelde Ankara’da yaşayan bireylerdir. Hasta bireylere ait kan örnekleri de yine aynı bölgede bulunan Ankara Üniversitesi Hastanesinde teşhis edilip, tedavi gören hastalara ait örneklerdir. Tablo I çalışmaya dahil edilen hastaların özelliklerini göstermektedir. Hastaların büyük kısmı (%84.1) uzun süredir günde bir paketin üzerinde sigara içen bireylerdir.

Daha önceden yapılan çalışmalar, beyaz ırka dahil bireylerden oluşan popülasyonlarda GSTM1 null allel frekansının %50 civarında olduğunu göstermiştir. Bu çalışmada elde edilen sonuç Türkiye’de (Orta Anadolu) genel popülasyondaki bireylerin %66’sının GSTM1 null genotipinde olduğunu göstermektedir. GSTM1 null allel frekansının Türk popülasyonunda yüksek olduğu anlaşılmaktadır, bununla beraber diğer pek çok çalışma değişik etnik gruplarda null allel frekansının %30 ile %70 arasında değişebildiğini ortaya koymuştur (17, 18, 19).

Akciğer kanser vakaları incelendiğinde vakaların %72.7sinin GSTM1 null olduğu gözlenmiştir. Normal bireylerle (%66) karşılaştırıldığı zaman akciğer kanserli hastalarda bir artış söz konusu olmasına karşın bu artış istatistiksel bir önem göstermemiştir (OR= 0.73; %95 CL=0.33-1.59) (Tablo II).

GSTM1 null allel frekansının yüksek olmasının akciğer kanser riskini artırdığını ileri süren çalışmalar bulunmasına karşın, diğer bazı çalışmalar bu genin kanser riskini artırmadığını savunmaktadır. Bu çalışmada da akciğer kanseri hastaları ile kontrol grubu arasında önemli bir farkın bulunmadığı gözlenmiştir.

GST enzim ailesine dahil theta sınıfı GSTT1 enzimi bazı detoksifikasyon reaksiyonlarında GSTM1 enzimi ile aynı yolakda rol almaktadır. Yine polimorfik bir lokus olan GSTT1 lokusunun gerek tek başına akciğer kanser gelişimine bir katkı sağlayıp sağlamadığının ortaya çıkarılması gerekse GSTM1 gen polimorfizimi ile bir sinerji gösterip göstermediğinin anlaşılması bundan sonra üzerinde durulması gereken önemli noktalardır.

KAYNAKLAR

Ketterer B, Harris JM, Talaska G, Meyer DJ, Pemble SE, Taylor JB, Lang NP, Kadlubar FF. The human glutathione S-transferase supergene family, its polymorphism and its effects on susceptibility to lung cancer. Environ Hlth Perspect 1992; 98: 87-94.

Deakin M, Elder J, Hendrickse C, Peckham D, Baldwin D, Pantin C, Wild N, Leopard P, Bell DA, Jones P, Duncan H, Brannigan K, Allderson J, Fryer A, Strange R.C. Gluthione S-transferase GSTT1 genotypes and susceptibility to cancer: studies of interactions with GSTM1 in lung, oral, gastric and colerectal cancers. Carcinogenesis 1996; 17:881-884.

Kihara M, Kihara M, Kubota A, Furukawa M, Kimura H. GSTM1 gene polymorphism as a possible marker for susceptibility to head and neck cancers among Japanese smokers. Cancer Lett 1997; 112:257-262,.

Kihara, M. Lung cancer risk of GSTM1 null genotype is enhanced in the presence of GSTP1 mutated genotype in male Japanese smokers. Cancer Lett 1999; 137:53-60.

Hirhovenen A, Husgafvel-Pursiainen K, Anttila S, Vainio, H. The GSTM1 null genotype as a potential risk modifier for squamous cell carcinoma of the lung. Carcinogenesis 1993; 14: 1479-1481.

To-Figueras J, Gene M, Gomez-Catalan J, Galan MC, Fuentes M, Ramon JM, Rodamilans M, Huguet E, Corbella J. Glutathione S-transferase M1 (GSTM1) and (GSTT1) polymorphisms and lung cancer risk among Northwestern Mediterraneans. Carcinogenesis 1997; 18: 1529-1533.

Kihara M, Noda K, Kihara M. Distribution of GSTM1 null genotype in relation to gender, age and smoking status in Japanese lung cancer patients. Pharmacogenetics, 1995; 5: S74-S79.

Sambrook J, Fritsch EF, Maniatis T. In: Molecular Cloning a Laboratory Manual, 2nd ed. Cold Spring Harbor, New York: Cold Spring Harbor Laboratory Press, 1989:9-19E,.

Zhong S, Forbes Howie AF, Ketterer B, Taylor J, Hayes JD, Beckett GJ, Wathen CG, Wolf CR, Spurr NK. Glutathione S-transferase mu locus: use of genotyping and phenotyping assays to assess association with lung cancer susceptibility. Carcinogenesis 1991; 12: 1533-1537.

Zhong S, Spurr NK, Hayes JD, Wolf CR. Deduced amino acid sequence, gene structure and chromosomal location of a novel human class Mu glutathione S- transferase; GSTM4. Biochem J 1993; 291: 41-50.

Alexandrie AK, Sundberg MI, Seidegard J, Tornling G, Rannug A. Genetic susceptibility to lung cancer with special emphasis on CYP1A1 and GSTM1: a study on host factors in relation to age at onset, gender and histological cancer types. Carcinogenesis 1994;15 1785-1790.

Garcia-Closas M, Kelsey KT, Wiencke JK, Xu X, Wain JC, Christiani DC. A case control study of cytochrome P450 1A1, glutathione S-Transferase M1, cigarette smoking and lung cancer susceptibility (Massachusetts, United States) Cancer Causes Control 1997; 8: 544-553.

Brockmoller J, Kerb R, Drakoulis N, Nitz M, Roots I. Genotype and phenotype of glutathione S-tansferase class mu isozymes m and j in lung cancer patients and controls. Cancer Res 1993; 53: 1004-1011.

Seidegard J, Pero M, Miller DG, Beattie EJ. A glutathione transferase in human leukocytes as a marker for susceptibility to lung cancer, Carcinogenesis 1986; 7: 751-753.

Seidegard J, Pero M, Markowittz M, Rouch G, Miller DG, Beattie EJ. Isozyme(s) of glutahione transferase (class Mu) as a marker for susceptibility to lung cancer: a follow up study. Carcinogenesis 1990; 11: 33-36.

Mc Williams JE, Sanderson BJS, Harris EL, Richert-Boe KE, Henner WD. Glutathione S-transferase M1 deficiency and lung cancer risk. Cancer Epidemiol. Biomarkers Preven 1995; 4: 589-594,.

Seidegard J, Pero M. The hereditary transmission of high glutathione transferase activity towards trans-stillbene oxide in human mononuclear leukocytes. Hum Genet 1985; 69: 66-68.

Board PG. Biochemical genetics of glutathione S-transferase. Am J Hum Genet 1981; 33: 36-43.

Bell DA, Thompson CL, Taylor JA, Miller CR, Perera F, Hsieh LL, Lucier GW. Genetic monitoring of human polymorphic cancer susceptibility genes by polymerase chain reaction: application to glutathione transferase m, Environ. Health Perspect 1992; 98: 113-117.

VII. Ekler

a) Mali Bilanço ve Açıklamaları

Proje kapsamında ARFO’dan 1.436.000.000 TL. alınmıştır. Tahsis edilen bu bütçe proje öneri formunda belirtilen bütçe detayına göre, aşağıda açıklandığı gibi kullanılmıştır.

Tüketim mal ve malzemeleri

Toplam

Kimyasal madde

787.000.000.-+KDV

965.000.000.-

Kırtasiye

20.000.000.-

20.000.000.-

Fotokopi

20.000.000.-

20.000.000.-

Bilgisayar

20.000.000.-

20.000.000.-

Toplam

1.025.000.000.-

Demirbaş alımları

Elektroforez tankı

410.000.000.-+KDV

471.000.000.-

GENEL TOPLAM

1.436.000.000.-

b) Makine ve Teçhizatın Konumu ve İlerideki Kullanımına Dair Açıklamalar

Bu proje kapsamında makine ve teçhizat alınmamıştır. Demirbaş malzeme olarak alınan elektroforez tankı bundan sonra gerçekleştirilecek moleküler biyoloji çalışmalarında da kullanılacaktır.

Yorum Yaz

Yorum Yazabilmek İçin Lütfen Giriş Yapın.